Journal: JCI insight

Article Title: YBX1 promotes type H vessel-dependent bone formation in an m5C-dependent manner.

doi: 10.1172/jci.insight.172345

Figure Lengend Snippet: Figure 2. Endothelial Ybx1 deletion impairs CD31hiEMCNhi endothelium formation and bone formation. (A and B) RT-qPCR analysis of Ybx1 expression in CD31hiEMCNhi ECs (A) and BMSCs (B) from EC-specific Ybx1-knockout female mice (Ybx1iΔEC) and their littermate controls (Ybx1fl/fl). (C) FACS analysis dot plot of CD31hiEMCNhi ECs in each group. (D) Quantification of type H (left) and L (right) ECs from in each group. (E and F) Representative images (E) and quantitation (F) of CD31 (green) and EMCN (red) immunostained, 4-week-old Ybx1iΔEC and Ybx1fl/fl femora. (G) ELISA analysis of estradiol levels in each group. (H) Representative images (left) and quantitation (right) of VEGFA (red) immunostained in each group. (I and J) Representative μCT imag- es (I) and quantitative μCT analysis (J) of trabecular bone microarchitecture of 4-week-old Ybx1iΔEC and Ybx1fl/fl mice. (K) Representative images (left) and quantitation (right) of Osterix+ (green) immunostained in each group. (L) Representative images (left) and quantitation (right) of COL1 (green)

Article Snippet: For the RNA pulldown experiment, BMP4- and CD31-specific biotinylated probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and incubated with YBX1 recombinant protein (NBP2-30101, Novus) at 4°C for 3 hours.

Techniques: Quantitative RT-PCR, Expressing, Knock-Out, Quantitation Assay, Enzyme-linked Immunosorbent Assay

Journal: JCI insight

Article Title: YBX1 promotes type H vessel-dependent bone formation in an m5C-dependent manner.

doi: 10.1172/jci.insight.172345

Figure Lengend Snippet: Figure 4. YBX1 depletion leads to decreasing CD31 and EMCN stability in an m5C-dependent manner. (A) Genomic distribution of YBX1 CLIP-Seq peaks. (B) Venn diagram representing the overlap genes between YBX1 CLIP-Seq targets and YBX1-knockdown RNA-Seq targets. (C) Top 2 ranked sequence motifs enriched in YBX1 CLIP-Seq. (D–F) Genomic view of YBX1 binding to CD31, EMCN, and BMP4 loci. The frame area is 3′-UTR. (G) Semiquantitative PCR showed RBP immunoprecipitates using m5C RIP kit. (H and I) RNA pulldown analysis of binding between YBX1 protein and CD31 (or BMP4)–WT (or MUT)–probe. (J) Relative luciferase activity of HEK293T cells transfected with different pGL-4 vectors and pCMV-YBX1. (K–M) RT-qPCR analysis of the BMP4, CD31, and EMCN mRNA degradation rate of HUVECs treated with shYBX1 (blue lines) or shControl (red lines). (N) Western blotting analysis of the relative levels of CD31, BMP4, EMCN, and YBX1 protein expression. n = 3 independent experiments. Data are shown as the mean ± SEM. ***P < 0.001 by 1-way ANOVA. CDS, coding sequences.

Article Snippet: For the RNA pulldown experiment, BMP4- and CD31-specific biotinylated probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and incubated with YBX1 recombinant protein (NBP2-30101, Novus) at 4°C for 3 hours.

Techniques: Knockdown, RNA Sequencing, Sequencing, Binding Assay, Luciferase, Activity Assay, Transfection, Quantitative RT-PCR, Western Blot, Expressing

Journal: JCI insight

Article Title: YBX1 promotes type H vessel-dependent bone formation in an m5C-dependent manner.

doi: 10.1172/jci.insight.172345

Figure Lengend Snippet: Figure 7. PEG-PLGA nanoparticles carrying sciadopitysin enhance angiogenesis-dependent bone formation in aged female mice. (A) Schematic diagram of treating aged female mice with sciadopitysin. (B and C) FACS analysis dot plot (B) and quantification (C) of CD31hiEMCNhi ECs from femora and tibia. (D) Western blotting analysis of YBX1 in CD31hiEMCNhi ECs (upper) and BMSCs (lower) from aged female mice injected with vehicle (PEG-PLGA nanoparticles) and PEG-PLGA nanoparticles carrying sciadopitysin (CD31 modified). (E and F) Representative μCT images (E) and quantitative μCT analysis (F) of trabecular bone microarchitecture of femora. (G and H) Representative images (G) and quantification (H) of calcein double labeling in femora. Scale bar 50 μm. (I–N) Representative images and quantification of H&E staining (I and J), Ocn staining (K and L), and TRAP staining (M and N) in trabecular bone surfaces. Scale bar 100 μm and 50 μm. (O and P) Representative images (O) and quantitation (P) of CD31 (green) and EMCN (red) immunostaining of tibia. (Q and R) Repre- sentative images (Q) and quantitation (R) of VEGFA-immunostained (green) tibia. (S and T) Representative images (S) and quantitation (T) of BMP4-immu- nostained (red) tibia. Femora and tibia were obtained from aged female mice injected with vehicle (PEG-PLGA nanoparticles) and PEG-PLGA nanoparticles carrying sciadopitysin (CD31 modified). Scale bar 100 μm. n = 7 mice in each group. n = 2 independent experiments. Data are shown as the mean ± SEM. **P < 0.01; ***P < 0.001 by Student’s t test.

Article Snippet: For the RNA pulldown experiment, BMP4- and CD31-specific biotinylated probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and incubated with YBX1 recombinant protein (NBP2-30101, Novus) at 4°C for 3 hours.

Techniques: Western Blot, Injection, Modification, Labeling, Staining, Quantitation Assay, Immunostaining

Journal: Cell reports

Article Title: Single mRNP Analysis Reveals that Small Cytoplasmic mRNP Granules Represent mRNA Singletons.

doi: 10.1016/j.celrep.2019.09.018

Figure Lengend Snippet: Figure 2. Structure of IMP1 and YBX1 mRNP Granules (A) HeLa cells were stained with anti-IMP1 and anti-YBX1 antibodies followed by Alexa Fluor 488 (green) and Alexa Fluor 647 (red) secondary antibodies, respectively. (A1–A3) Overview of the cell. Scale bars, 5 mm. (A4–A6) Blow-up of IMP1 and YBX1 granules in the indicated area (white square) in (A3). Scale bar, 0.2 mm. (A7) P bodies depicted by DCP1a-EGFP in combination with IMP1 staining and A8, pHcRed-G3BP in stress granules in combination with IMP1 staining. (B) IMP1 (green, Alexa Fluor 488) and YBX1 (red, Alexa Fluor 647) immunostaining in combination with ACTB mRNA FISH (cyan) using 48 Quasar 570 dye-labeled oligonucleotides corresponding to the entire ACTB mRNA. (B1–B4) Overview of a HeLa cell. Scale bars, 5 mm. (B5–B9) blow up of ACTB mRNA and IMP1_YBX1 containing granules. Scale bars, 0.2 mm (B5) and 0.1 mm (B6–B9). (B10–B19) IMP1 (green, Alexa Fluor 488) and YBX1 (red, Alexa Fluor 647) immunostaining in combination with GAPDH mRNA FISH (cyan) using 48 Quasar 570 dye-labeled (cyan) oligonucleotides corresponding to the entire GAPDH mRNA. (B10–B14) Overview of a HeLa cell. Scale bars, 5 mm. (B15–B19) Blow-up of GAPDH mRNA and IMP1_YBX1 containing granules. Scale bars, 0.2 mm (B15) and 0.1 mm (B16–B19). (B20 and B21) Double FISH with ACTB mRNA (red, Quasar 670-conjugated probes) and GAPDH mRNA (green, Quasar 570-conjugated probes) in combination with YBX1 immunostaining (gray, Alexa Fluor 488). (C) EGFP immunoprecipitation of transiently transfected HeLa cells with pEGFP-C1 (control) and pEGFP-IMP1. Immunodetection of GFP and GFP-IMP1, endogenous IMP1, YBX1, and GADPH, respectively, was performed in total lysate and immunoprecipitated (IP) fractions without () or with (+) RNase A treatment.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-IMP1 (raised against C-terminal peptide) Nielsen et al., 1999 N/A Goat polyclonal anti-IMP1 Santa Cruz Biotechnology Cat#E-20; RRID: AB_649425 Rabbit polyclonal anti-YBX1 Abcam Cat#ab12148; RRID: AB_2219278 Rabbit polyclonal anti-GAPDH Santa Cruz Biotechnology Cat#FL-335; RRID: AB_10167668 Mouse monoclonal anti-GFP Abcam Cat#ab1218; RRID: AB_298911 Mouse monoclonal anti-Nup153 Abcam Cat#ab24700; RRID: AB_2154467 Mouse monoclonal anti-PABPC1 Abcam Cat#ab6125; RRID: AB_2156878 Chemicals, Peptides, and Recombinant Proteins Recombinant human IMP1 Nielsen et al., 1999 N/A Recombinant human YBX1 Origene Cat#TP309835 Critical Commercial Assays Click-iT Plus OPP Alexa Fluor 488 Protein Synthesis Assay Kit Invitrogen Cat#C10456 Experimental Models: Cell Lines HeLa cell line ATCC CCL-2 Oligonucleotides siRNA against YBX1 30UTR 50 - GAACAGGCCUGGUGGGAAAUU - 30 (sense) 50 - UUUCCCACCAGGCCUGUUCUU 30 (antisense) Eurofins Genomics N/A Stellaris FISH Probes, Human ACTB with Quasar 570 Dye LGC Biosearch Cat#VSMF-2002-5 Stellaris FISH Probes, Human ACTB with Quasar 670 Dye LGC Biosearch Cat#VSMF-2003-5 Stellaris FISH Probes, Human GAPDH with Quasar 570 Dye LGC Biosearch Cat#SMF-2026-1 Recombinant DNA pEGFP-C1 Clontech N/A pEGFP-IMP1 This manuscript N/A pEGFP-IMP1_KH1-4mut This manuscript N/A pcDNA3.1+N-EGFP-YBX1 Genscript N/A pmCherry-YBX1 This manuscript N/A pmEos3.2-IMP1 This manuscript N/A PABPC1-GFP This manuscript N/A DCP1a-GFP This manuscript N/A pHcRed1-G3BP This manuscript N/A Software and Algorithms ZEN 2012 Carl Zeiss Microscopy N/A RStudio R Foundation N/A

Techniques: Staining, Immunostaining, Labeling, Immunoprecipitation, Transfection, Control, Immunodetection

Journal: Cell reports

Article Title: Single mRNP Analysis Reveals that Small Cytoplasmic mRNP Granules Represent mRNA Singletons.

doi: 10.1016/j.celrep.2019.09.018

Figure Lengend Snippet: Figure 3. IMP1 and YBX1 mRNP Formation at the Nuclear Pore HeLa cells were stained with anti-IMP1, anti-YBX1, and anti-NUP153 primary antibodies followed by Alexa Fluor 488 (green), Alexa 555 (cyan), and Alexa Fluor 647 (red) secondary antibodies, respectively. Moreover, the nucleus was stained with DAPI (deep blue). (A) Overview of a triple-stained cell and the area that is shown in the blow-up below. Scale bar, 2 mm. (B–E) Individual IMP1 (B), YBX1 (C), NUP153 (D), and DAPI (E) stainings. (F) Composite picture demonstrating the colocalization of NUP153 and the IMP1_YBX1 mRNP. Scale bar, 200 nm. Arrows indicate nuclear pores.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-IMP1 (raised against C-terminal peptide) Nielsen et al., 1999 N/A Goat polyclonal anti-IMP1 Santa Cruz Biotechnology Cat#E-20; RRID: AB_649425 Rabbit polyclonal anti-YBX1 Abcam Cat#ab12148; RRID: AB_2219278 Rabbit polyclonal anti-GAPDH Santa Cruz Biotechnology Cat#FL-335; RRID: AB_10167668 Mouse monoclonal anti-GFP Abcam Cat#ab1218; RRID: AB_298911 Mouse monoclonal anti-Nup153 Abcam Cat#ab24700; RRID: AB_2154467 Mouse monoclonal anti-PABPC1 Abcam Cat#ab6125; RRID: AB_2156878 Chemicals, Peptides, and Recombinant Proteins Recombinant human IMP1 Nielsen et al., 1999 N/A Recombinant human YBX1 Origene Cat#TP309835 Critical Commercial Assays Click-iT Plus OPP Alexa Fluor 488 Protein Synthesis Assay Kit Invitrogen Cat#C10456 Experimental Models: Cell Lines HeLa cell line ATCC CCL-2 Oligonucleotides siRNA against YBX1 30UTR 50 - GAACAGGCCUGGUGGGAAAUU - 30 (sense) 50 - UUUCCCACCAGGCCUGUUCUU 30 (antisense) Eurofins Genomics N/A Stellaris FISH Probes, Human ACTB with Quasar 570 Dye LGC Biosearch Cat#VSMF-2002-5 Stellaris FISH Probes, Human ACTB with Quasar 670 Dye LGC Biosearch Cat#VSMF-2003-5 Stellaris FISH Probes, Human GAPDH with Quasar 570 Dye LGC Biosearch Cat#SMF-2026-1 Recombinant DNA pEGFP-C1 Clontech N/A pEGFP-IMP1 This manuscript N/A pEGFP-IMP1_KH1-4mut This manuscript N/A pcDNA3.1+N-EGFP-YBX1 Genscript N/A pmCherry-YBX1 This manuscript N/A pmEos3.2-IMP1 This manuscript N/A PABPC1-GFP This manuscript N/A DCP1a-GFP This manuscript N/A pHcRed1-G3BP This manuscript N/A Software and Algorithms ZEN 2012 Carl Zeiss Microscopy N/A RStudio R Foundation N/A

Techniques: Staining

Journal: Cell reports

Article Title: Single mRNP Analysis Reveals that Small Cytoplasmic mRNP Granules Represent mRNA Singletons.

doi: 10.1016/j.celrep.2019.09.018

Figure Lengend Snippet: Figure 7. Molecular Composition of IMP1_YBX1 mRNP The number of IMP1, YBX1, and ACTB mRNA molecules in the mRNP were derived from localization microscopy (LM) or from FCS and compared with the average number of binding sites in the transcriptome from eCLIP and RNA immunoprecipitation sequencing analysis. For localization microscopy, cells were stained for IMP1, YBX1, and ACTB mRNA, and following bleaching, mRNP emitted photons were counted as described. (A) Examples of the localization microscopy images of YBX1 (red), IMP1 (green), and ACTB mRNA (cyan), respectively. Scale bar, 100 nm. (B) Counts per particle derived from FCS of cells transfected with GFP, GFP-IMP1_KH1-4mut, GFP-IMP1, GFP-YBX1, and with co-transfection of YBX1 30 UTR- directed siRNA and GFP-YBX1. Laser power was 0.02% in all measurements. (C) Summary of the data from localization microscopy, FCS, and binding sites predicted from either eCLIP (IMP1) or RNA immunoprecipitation sequencing (YBX1) experiments. (D) Immunofluorescence staining of PABPC1 (cyan, Alexa Fluor 488), IMP1 (green, Alexa Fluor 568), and YBX1 (red, Alexa Fluor 647). An overview of a whole HeLa cell is shown in the panel above (scale bar, 5 mm), and a blow-up image of the triple PABPC1, IMP1, and YBX1 staining of the area squared in the panel above is shown below (scale bar, 0.2 mm). Positioning of PABPC1 (cyan) in individual mRNPs depicted by YBX1 (red) staining is shown in the panel below (scale bar, 0.1 mm).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-IMP1 (raised against C-terminal peptide) Nielsen et al., 1999 N/A Goat polyclonal anti-IMP1 Santa Cruz Biotechnology Cat#E-20; RRID: AB_649425 Rabbit polyclonal anti-YBX1 Abcam Cat#ab12148; RRID: AB_2219278 Rabbit polyclonal anti-GAPDH Santa Cruz Biotechnology Cat#FL-335; RRID: AB_10167668 Mouse monoclonal anti-GFP Abcam Cat#ab1218; RRID: AB_298911 Mouse monoclonal anti-Nup153 Abcam Cat#ab24700; RRID: AB_2154467 Mouse monoclonal anti-PABPC1 Abcam Cat#ab6125; RRID: AB_2156878 Chemicals, Peptides, and Recombinant Proteins Recombinant human IMP1 Nielsen et al., 1999 N/A Recombinant human YBX1 Origene Cat#TP309835 Critical Commercial Assays Click-iT Plus OPP Alexa Fluor 488 Protein Synthesis Assay Kit Invitrogen Cat#C10456 Experimental Models: Cell Lines HeLa cell line ATCC CCL-2 Oligonucleotides siRNA against YBX1 30UTR 50 - GAACAGGCCUGGUGGGAAAUU - 30 (sense) 50 - UUUCCCACCAGGCCUGUUCUU 30 (antisense) Eurofins Genomics N/A Stellaris FISH Probes, Human ACTB with Quasar 570 Dye LGC Biosearch Cat#VSMF-2002-5 Stellaris FISH Probes, Human ACTB with Quasar 670 Dye LGC Biosearch Cat#VSMF-2003-5 Stellaris FISH Probes, Human GAPDH with Quasar 570 Dye LGC Biosearch Cat#SMF-2026-1 Recombinant DNA pEGFP-C1 Clontech N/A pEGFP-IMP1 This manuscript N/A pEGFP-IMP1_KH1-4mut This manuscript N/A pcDNA3.1+N-EGFP-YBX1 Genscript N/A pmCherry-YBX1 This manuscript N/A pmEos3.2-IMP1 This manuscript N/A PABPC1-GFP This manuscript N/A DCP1a-GFP This manuscript N/A pHcRed1-G3BP This manuscript N/A Software and Algorithms ZEN 2012 Carl Zeiss Microscopy N/A RStudio R Foundation N/A

Techniques: Derivative Assay, Microscopy, Binding Assay, RNA Immunoprecipitation, Sequencing, Staining, Transfection, Cotransfection

Journal: Cell Death & Disease

Article Title: MTA2 silencing attenuates the metastatic potential of cervical cancer cells by inhibiting AP1-mediated MMP12 expression via the ASK1/MEK3/p38/YB1 axis

doi: 10.1038/s41419-021-03729-1

Figure Lengend Snippet: SiHa cells were transfected with shRNA against MTA2 (shMTA2) and then subjected to ( A ) nucleus fractionation and immunodetection of nuclear MTA2, phosphylated YB1 (p-YB1), and YB1 or ( B ) immunofluorescent detection of MTA2, p-YB1, and MMP12 by confocal microscopy. ( C – E) Cells were transfected with shMTA2 and siRNA against YB1 (si-YB1) and then subjected to ( C ) migration and invasion assay, ( D ) AP1 reporter assay, or ( E ) MMP12 mRNA assessment via qRT-PCR. F Cells were transfected with shMTA2 and then subjected to immunoprecipitation by using anti-p-YB1 antibody and immunodetection of the indicated poteins. ( G , H) Cells were transfected with shMTA2 combined with siRNA against ASK1 (si-ASK1), MEK3 (si-MEK3), or p38 (si-p38) and then subjected to ( G ) immunodetection of the indicated proteins or ( H ) MMP12 mRNA expression assessment via qRT-PCR. ** and #, P < 0.01 and P < 0.05 compared with shLuc and shMTA2 cells alone, respectively.

Article Snippet: Small inhibitory RNAs (siRNAs) specifically targeting ASK1 (siASK1; a pool of sc-29748A, sc-29748B, and sc-29748C), MEK3 (si-MEK3; sc-43924), YB1 (si-YB1; sc-38634), and p38 (si-p38; a pool of sc-29433A, sc-29433B, sc-29433C, and sc-29433D), as well as a scrambled control siRNA, were constructed by and obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Transfection, shRNA, Fractionation, Immunodetection, Confocal Microscopy, Migration, Invasion Assay, Reporter Assay, Quantitative RT-PCR, Immunoprecipitation, Expressing

Journal: Cell Death & Disease

Article Title: MTA2 silencing attenuates the metastatic potential of cervical cancer cells by inhibiting AP1-mediated MMP12 expression via the ASK1/MEK3/p38/YB1 axis

doi: 10.1038/s41419-021-03729-1

Figure Lengend Snippet: Our findings indicate that MTA2 knockdown induces activation of the ASK1/MEK3/p38 cascade, which subsequently leads to YB1 phosphorylation and the binding of p-YB1 and AP1, inhibiting AP1 transcriptional activity and MMP12 expression, thereby reducing cervical cancer metastasis.

Article Snippet: Small inhibitory RNAs (siRNAs) specifically targeting ASK1 (siASK1; a pool of sc-29748A, sc-29748B, and sc-29748C), MEK3 (si-MEK3; sc-43924), YB1 (si-YB1; sc-38634), and p38 (si-p38; a pool of sc-29433A, sc-29433B, sc-29433C, and sc-29433D), as well as a scrambled control siRNA, were constructed by and obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Knockdown, Activation Assay, Phospho-proteomics, Binding Assay, Activity Assay, Expressing

Journal: Cell Death & Disease

Article Title: TAGLN2 induces resistance signature ISGs by activating AKT-YBX1 signal with dual pathways and mediates the IFN-related DNA damage resistance in gastric cancer

doi: 10.1038/s41419-024-07000-1

Figure Lengend Snippet: A Quantitative RT‒PCR analysis confirmed the effect of YBX1 on TAGLN2-mediated ISG upregulation. B The endogenous interaction between TAGLN2 and the YBX1 promoter was evaluated by ChIP‒qPCR in BGC-823 cells. C The dual-luciferase reporter assay results showed that overexpression of TAGLN2 activated the transcriptional activity of YBX1 by binding to the promoter region (−334 to −1 bp). D The transcriptional regulation effect of YBX1 and 11 candidate transcription factors (ETV4, E2F1, GATA4, ELK1, ZNF263, TFAP2A, TEAD4, c-Myc, SOX9, SP1 and Twist) was evaluated by luciferase reporter assays in both BGC-823 and MGC-803 cells. YBX1-8 promoter region was abbreviated as Y8 for short. E Co-IP assays demonstrated that SOX9 and c-Myc, but not SP1, interacted with TAGLN2. * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: After deparaffinization in xylene, rehydration through graded alcohols, and heat treatment for antigen retrieval, slides were then blocked and stained with one of the following antibodies to process immunofluorescence staining for 1 h: TAGLN2 (1:500), YBX1 (1:4000, Novus Biologicals), and CK (1:2, Abcarta Medtech Co., Ltd, China).

Techniques: Luciferase, Reporter Assay, Over Expression, Activity Assay, Binding Assay, Co-Immunoprecipitation Assay

Journal: Cell Death & Disease

Article Title: TAGLN2 induces resistance signature ISGs by activating AKT-YBX1 signal with dual pathways and mediates the IFN-related DNA damage resistance in gastric cancer

doi: 10.1038/s41419-024-07000-1

Figure Lengend Snippet: A , B The endogenous interaction between SOX9 or c-Myc and the YBX1 promoter was identified by ChIP-qPCR and agarose gel electrophoresis. C The critical role of TAGLN2 in upregulating the expression of YBX1 at the transcriptional level was identified by luciferase reporter assay in MGC-803 cells. D Quantitative RT-PCR analysis showed that overexpression or downregulation of either c-Myc or SOX9 resulted in a substantial increase or decrease in the expression levels of YBX1 and five representative ISGs in both BGC-823 and MGC-803 cells, respectively. E Modulation of the expression of c-Myc , TAGLN2 , SOX9 or YBX1 influenced the expression of pISRE-TA-Luc, as determined by luciferase reporter assay. F Luciferase reporter assay was used to analyze the expression of pISRE-TA-Luc by modulating the proteins involved in the cGAS-STING pathway, including cGAS , STING , IRF3 and IFNAR . G Expression of PDL1 was detected in BGC-823 cells with YBX1 or TAGLN2 overexpression, or TAGLN2 overexpression meanwhile si cGAS , si STING , si IRF3 or si IFNAR treatment. * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: After deparaffinization in xylene, rehydration through graded alcohols, and heat treatment for antigen retrieval, slides were then blocked and stained with one of the following antibodies to process immunofluorescence staining for 1 h: TAGLN2 (1:500), YBX1 (1:4000, Novus Biologicals), and CK (1:2, Abcarta Medtech Co., Ltd, China).

Techniques: ChIP-qPCR, Agarose Gel Electrophoresis, Expressing, Luciferase, Reporter Assay, Quantitative RT-PCR, Over Expression

Journal: Cell Death & Disease

Article Title: TAGLN2 induces resistance signature ISGs by activating AKT-YBX1 signal with dual pathways and mediates the IFN-related DNA damage resistance in gastric cancer

doi: 10.1038/s41419-024-07000-1

Figure Lengend Snippet: A The interaction between TAGLN2 and YBX1 was tested in both endogenous and exogenous Co-IP assays. B Various fragments of TAGLN2 and YBX1 were constructed to identify the molecular mechanism underlying the interaction of TAGLN2, YBX1 and AKT by Co-IP assay. C Purified HA-YBX1, Flag-TAGLN2 and GST-AKT proteins were prepared for the in vitro pull-down assay. An enhanced interaction between YBX1 and AKT was observed when the TAGLN2 protein input was increased from 100 μg to 200 μg. D Fisetin (2 nM or 4 nM) was used to suppress the interaction between AKT and YBX1. E TAGLN2 regulated the level of YBX1 phosphorylation and enhanced its cytoplasmic to nuclear translocation, followed by type I IFN activation. F Western blot analysis of total YBX1 and p -YBX1 for cytoplasmic and nuclear protein separation from BGC-823 cells transfected either with long-length TAGLN2, the fragment containing the complete CH domain (aa 47~153) or part of the CH domain (aa 107~219).

Article Snippet: After deparaffinization in xylene, rehydration through graded alcohols, and heat treatment for antigen retrieval, slides were then blocked and stained with one of the following antibodies to process immunofluorescence staining for 1 h: TAGLN2 (1:500), YBX1 (1:4000, Novus Biologicals), and CK (1:2, Abcarta Medtech Co., Ltd, China).

Techniques: Co-Immunoprecipitation Assay, Construct, Purification, In Vitro, Pull Down Assay, Phospho-proteomics, Translocation Assay, Activation Assay, Western Blot, Transfection

Journal: Cell Death & Disease

Article Title: TAGLN2 induces resistance signature ISGs by activating AKT-YBX1 signal with dual pathways and mediates the IFN-related DNA damage resistance in gastric cancer

doi: 10.1038/s41419-024-07000-1

Figure Lengend Snippet: A ~ C Multiplex immunofluorescence of TMA was performed using the Opal 7-color Manual IHC Kit and VECTASHIELD ® HardSet Antifade Mounting Medium. The multiplex antibody panel was optimized as follows: TAGLN2, Opal 520 (yellow); CK, Opal 570 (green); YBX1, Opal 620 (red). The TMA was counterstained with DAPI (blue) and incubated with an antifluorescence quencher. Expression and spatial distribution of TAGLN2 or YBX1 in tissues and the correlation with patient clinical data. The DAPI channel was used to identify individual cells. A tissue segmentation algorithm combined with CK staining was applied to define tumoral and stromal areas. The scale bar is 200 μm. D Fisetin or MK2206 inhibited the accumulation of cytosolic ssDNA induced by overexpression of TAGLN2 by BrdU-γH2AX double labeling. HGC-27 cells stably transfected with TAGLN2 were prelabeled with BrdU and subsequently treated with 1 μg/ml Cisplatin with or without 10 μM Fisetin or 200 nM MK2206 in the medium. Cells were stained for DNA (DAPI, blue), the primary BrdU antibody (red) and phospho-histone H2AX (green). E Relative mRNA levels of the panel of IFN-related genes with or without 10 μM Fisetin or 200 nM MK2206 in the medium after 6 Gy X-ray treatment were evaluated by quantitative RT‒PCR analysis. The cytotoxicity induced by MK2206 from 16.25 nM to 13 μM ( F ) or MK2206 (200 nM) and Cisplatin (0.4 μg/ml) combination on tumor cells was detected ( G ). * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: After deparaffinization in xylene, rehydration through graded alcohols, and heat treatment for antigen retrieval, slides were then blocked and stained with one of the following antibodies to process immunofluorescence staining for 1 h: TAGLN2 (1:500), YBX1 (1:4000, Novus Biologicals), and CK (1:2, Abcarta Medtech Co., Ltd, China).

Techniques: Multiplex Assay, Immunofluorescence, Incubation, Expressing, Staining, Over Expression, Labeling, Stable Transfection, Transfection

Journal: Cell Death & Disease

Article Title: TAGLN2 induces resistance signature ISGs by activating AKT-YBX1 signal with dual pathways and mediates the IFN-related DNA damage resistance in gastric cancer

doi: 10.1038/s41419-024-07000-1

Figure Lengend Snippet: A – C A subcutaneous mouse model was established to confirm the effects of TAGLN2 and associated axis on tumor growth in vivo. The mice were injected subcutaneously with 2 × 10 6 BGC-823 cells with (NC group) or without TAGLN2 overexpression (TAGLN2 group) in 0.2 ml of PBS. Intraperitoneal administration of Cisplatin (3 mg/kg, every 4 days), MK2206 by intragastric gavage (120 mg/kg, every 4 days), or a combination of both (MK2206 was administrated 2 days before Cisplatin administration), or PBS was given in control group. Tumor volume, body weight and tumor weight were measured. (D&E) Representative protein set (TAGLN2, YBX1, IFIT1, IFIT2, IFIT3, OAS3 and ISG15) staining in tumors derived from NC or TAGLN2 group with Cisplatin, MK2206, or a combination of both treatment. The results were obtained by multiplying the PP by the IS (score = PP × IS). * P < 0.05, ** P < 0.01, *** P < 0.001. The scale bar is 10 μm.

Article Snippet: After deparaffinization in xylene, rehydration through graded alcohols, and heat treatment for antigen retrieval, slides were then blocked and stained with one of the following antibodies to process immunofluorescence staining for 1 h: TAGLN2 (1:500), YBX1 (1:4000, Novus Biologicals), and CK (1:2, Abcarta Medtech Co., Ltd, China).

Techniques: In Vivo, Injection, Over Expression, Control, Staining, Derivative Assay

Journal: Cell Death & Disease

Article Title: TAGLN2 induces resistance signature ISGs by activating AKT-YBX1 signal with dual pathways and mediates the IFN-related DNA damage resistance in gastric cancer

doi: 10.1038/s41419-024-07000-1

Figure Lengend Snippet: A Clinical analysis of the experimentally derived nine-gene pair ( IFIT1, IFIT2, IFIT3, ISG15, IFI16, OAS3, WARS, YBX1, TAGLN2 ). The survival curves were plotted by the Kaplan‒Meier method and tested by log-rank analysis. The clinical characteristics of patients with different protein expression levels were compared by using a two-tailed chi-square test with SPSS 20 software. B Expression of IRDS genes also positively correlated with the expression of PDL1 or IDO1 , respectively. C The RandomForest algorithm based on Python sklearn was used to construct the model, and receiver operating characteristic (ROC) curve analysis was used to evaluate the predictive accuracy and sensitivity of the therapy prediction model. Outcomes were divided into therapy sensitivity (including CR complete remission, PR partial remission/response, SD stable disease) and therapy resistance (PD progressive disease) based on the data of “primary_therapy_outcome_success”. D Immune cell proportion analysis. Formatted data were uploaded to the CIBERSORT web portal to analyze immune cell proportions ( https://cibersort.standord.edu ./). * P < 0.05, ** P < 0.01, *** P < 0.001. E Schematic diagram of the role of TAGLN2-mediated AKT-YBX1 pathway activation in IFN-related DNA damage resistance.

Article Snippet: After deparaffinization in xylene, rehydration through graded alcohols, and heat treatment for antigen retrieval, slides were then blocked and stained with one of the following antibodies to process immunofluorescence staining for 1 h: TAGLN2 (1:500), YBX1 (1:4000, Novus Biologicals), and CK (1:2, Abcarta Medtech Co., Ltd, China).

Techniques: Derivative Assay, Expressing, Two Tailed Test, Software, Construct, Activation Assay

Journal: The Journal of Biological Chemistry

Article Title: The RNA methyltransferase NSUN2 catalyzes 5-methylcytosine (m 5 C) on IL1B mRNA to promote transcript stability

doi: 10.1016/j.jbc.2026.111290

Figure Lengend Snippet: YBX1, acting as an m 5 C reader, collaborates with NSUN2 to facilitate the expression of inflammatory cytokines in DPCs. A , total RNA was purified from DPCs stimulated with LPS. RT-PCR analyzed the mRNA expression of the m 5 C reader ( YBX1 , YTHDF2 , and ALYREF) and inflammatory cytokines ( IL-1β and IL-6 ). β-actin served as a loading control. Data are means ± SD, n = 3. B , representative IHC staining of YBX1 expression in normal (n = 6) and pulpitis (n = 5) teeth . The scale bars represent 50 μm. P: pulp tissue; D: dentine. C , the expression of YBX1 in dental pulp detected by IHC was quantified as the average optical density (AOD) using ImageJ software and IHC Toolbox plugin. D , measurement of YBX1 mRNA expression analyzed by RT-qPCR in normal (n = 7) and pulpitis (n = 8) teeth . β-actin served as a loading control. E–G , DPCs were transfected with either Myc-tagged YBX1 or empty vector (control) plasmids. The transcriptional levels of IL1B and IL6 ( E ), as well as CXCL10 ( F ) and CCL2 ( G ), were detected by RT-PCR. β-actin served as a loading control. Data are means ± SD, n = 3 or 4. H , western blot confirmed the overexpression efficiency of YBX1. The anti-Myc antibody was used to detect the Myc-tagged fusion protein. GAPDH served as a loading control. I–K , DPCs were treated with LPS or PBS after transfection with either siYBX1 or siNC. I , knockdown efficiency of siYBX1 was confirmed by western blot. GAPDH served as a loading control. J and K , RT-PCR was employed to illustrate the effect of YBX1 knockdown on the mRNA levels of IL1B and CXCL10 ( J ) as well as IL6 and CCL2 ( K ) in DPCs. β-actin served as a loading control. Data are means ± SD, n = 3 or 4. L–N The interaction between YBX1 and IL1B transcripts were analyzed by RNA immunoprecipitation (RIP) using anti-YBX1 antibody, with normal rabbit IgG as the isotype control. L and N , immunoprecipitated RNA was analyzed by RT-PCR. L , endogenous IL1B transcripts bound by YBX1. N , exogenous GFP-IL1B transcripts bound by YBX1. The histogram below showed the percentage of GFP-ILB mRNA co-immunoprecipitated with YBX1 relative to Input levels. Data are means ± SD, n = 3. M and N , immunoprecipitated YBX1 protein was confirmed by western blot. O , the mRNA half-life of IL1B in DPCs transfected with siYBX1. siNC was used as a negative control and β-actin served as a loading control. Data are means ± SD, n = 4. P–R , DPCs with or without NSUN2 overexpression were transfected with siYBX1 or siNC. The expression levels of IL1B and CCL2 ( P ), as well as IL6 and CXCL10 ( Q ), were detected by RT-PCR. β-actin served as a loading control. Data are means ± SD, n = 3 or 4. R , the overexpression of NSUN2 and the knockdown efficiency of siYBX1 were analyzed by western blot. GAPDH served as a loading control. S , RIP-PCR analysis of the interaction between YBX1 and IL1B mRNA in NSUN2 knockdown and control DPCs. T , schema of the mechanism by which NSUN2 collaborating with YBX1 promotes the progression of dental pulp inflammation. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001. ALYREF, Aly/REF export factor; CCL2, C-C motif chemokine ligand 2; CXCL10, C-X-C motif chemokine ligand 10; DPCs, dental pulp cells; IL1B, interleukin 1 beta; LPS, lipopolysaccharides; m5C, 5-methylcytosine; NSUN, NOP2/Sun RNA methyltransferase; RT-PCR, semiquantitative reverse transcription PCR; RT-qPCR, real-time quantitative reverse transcription PCR; YBX1, Y-box binding protein 1.

Article Snippet: After blocked in 5% defatted milk, the membranes were incubated with the following antibodies: rabbit monoclonal anti-NSUN2 (#ab259941, 1:2000, Abcam), rabbit monoclonal anti-YBX1 (#ab76149, 1:2000, Abcam), mouse monoclonal anti-YBX1 (#TA806283, 1:1000, Origene Technologies), rabbit anti-FLAG antibody (#20543, 1:2000, Proteintech), rabbit anti-MYC antibody (#10828, 1:2000, Proteintech), and mouse anti-GAPDH (#sc-47724, 1:1000, Santa Cruz Biotechnology).

Techniques: Expressing, Purification, Reverse Transcription Polymerase Chain Reaction, Control, Immunohistochemistry, Software, Quantitative RT-PCR, Transfection, Plasmid Preparation, Western Blot, Over Expression, Knockdown, RNA Immunoprecipitation, Immunoprecipitation, Negative Control, Reverse Transcription, Binding Assay